Complete information for AGAP2-AS1 gene (RNA Gene), AGAP2 Antisense RNA 1, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium

18 Sep 2020 The lncRNA AGAP2 antisense RNA 1 (AGAP2-AS1) is Keywords: LncRNA, AGAP2-AS1, papillary thyroid cancer, miR-424-5p, MMP2.

AFAP1L1, AFAP1L2, AFDN, AFF1, AFF2, AFF3, AFF4, AFG3L2, AFMID, AFTPH, AGA, AGAP1, AGAP2, AGAP2-AS1, AGAP3, AGBL5, AGFG1, AGFG2, AGGF1 AGAP2-AS1 100130776 AGAP2 antisense RNA 112. 58120023. 58122139 +. -0,112. 34,114. 0,176.

Agap2-as1

AGAP2-AS1 expression was upregulated and associated with poor prognosis of NSCLC. To investigate lncRNA expression levels in NSCLC tissues compared with normal tissues, we first analyzed the 2017-02-16 · AGAP2-AS1 was highly expressed in the GC tissues and cell lines, and patients with higher AGAP2-AS1 expression had a poorer prognosis and shorter overall survival. Furthermore, knockdown of AGAP2-AS1 significantly inhibited GC cell proliferation, migration, and invasion in vitro and tumor growth in vivo. AGAP2-AS1 has 521 functional associations with biological entities spanning 3 categories (chemical, cell line, cell type or tissue, gene, protein or microRNA) extracted from 15 datasets. Click the + buttons to view associations for AGAP2-AS1 from the datasets below. If available, associations are ranked by standardized value AGAP2-AS1 dysregulation and characterize the mech-anism by which AGAP2-AS1 regulates its targets in the GC cells. Taken together, the obtained findings may provide new insights into the critical role of the lncRNA AGAP2-AS1 in human GC tumorigenesis and progression.

Overexpression of AGAP2-AS1 promoted cell growth, suppressed apoptosis, and caused trastuzumab resistance, whereas knockdown of AGAP2-AS1 showed an opposite effect. Recently, the lncRNA AGAP2-AS1 was identified as an oncogenic lncRNA in human non-small cell lung cancer (NSCLC) and its elevated expression was linked to NSCLC development and progression.

Complete information for SATB2-AS1 gene (RNA Gene), SATB2 Antisense RNA 1, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium

2017-02-16 · AGAP2-AS1 functions as an oncogenic lncRNA by interacting with LSD1 and EZH2 and suppressing CDKN1A (P21) and E-cadherin transcription. CONCLUSIONS: Taken together, these findings imply that AGAP2-AS1 upregulated by SP1 plays an important role in GC development and progression by suppressing P21 and E-cadherin, which suggests that AGAP2-AS1 is a potential diagnostic marker and therapeutic 2019-05-14 · AGAP2-AS1-suppressive HCCLM3 cells that were transfected with anti-miR-16-5p were subjected to qRT-PCR for miR-16-5p. miR-16-5p restoration abrogated the effects of AGAP2-AS1 overexpression on cell proliferation (h), migration (i), invasion (j), EMT process (l) and apoptosis (k) of Hep3B cells. miR-16-5p knockdown reversed the suppressive effects of AGAP2-AS1 knockdown in HCCLM3 cells (h-l).

Sigma-Aldrich offers abstracts and full-text articles by [Huaying Dong, Wei Wang, Shaowei Mo, Ru Chen, Kejian Zou, Jing Han, Fan Zhang, Jianguo Hu].

Title: AGAP2-AS1 regulates AGAP2 mRNA levels Abstract: AGAP2-AS1 is an antisense lncRNA situated in the 3’ end of AGAP2. It is becoming now more widely accepted that 3’ antisense lncRNAs can modify the expression of their gene counterparts and we demonstrate here that this is the case as well for the tandem AGAP2 – AGAP2-AS1. 2021-02-18 2021-02-01 AGAP2-AS1 leads to a decrease in cell proliferation and migration, along with the repression of invasion and tumorigenesis.7,8 However, it remains unknown as to whether AGAP2-AS1 inﬂuences cancer progression in EC. Additionally, microRNAs (miRNAs), endogenous non-protein-cod- AGAP2-AS1 dysregulation and characterize the mech-anism by which AGAP2-AS1 regulates its targets in the GC cells. Taken together, the obtained findings may provide new insights into the critical role of the lncRNA AGAP2-AS1 in human GC tumorigenesis and progression. Methods Tissue samples and cell lines Fifty paired GC and adjacent nontumor Complete information for AGAP2-AS1 gene (RNA gene), AGAP2 antisense RNA 1, including: function, proteins, disorders, pathways, orthologs, and expression. GeneCards - The Human Gene Compendium Select categories you would like to watch.

96. (PBonf<0.0023, Pcombined = 1.1x10-9, 1.4x10-8, 1.7x10-6, 2, AGAP2-AS1 (AGAP2 Antisense RNA 1), miR-16-5p, ANXA11, 31088485. 3, AK054386, miR-199, None specified, 31827704. 4, ANRIL (CDKN2B antisense 9 Mar 2017 Additional file 1: Table S1. of Long noncoding AGAP2-AS1 is activated by SP1 and promotes cell proliferation and invasion in gastric cancer. 23 Mar 2020 AGAP2-AS1 promoted CRC cell proliferation and inhibited apoptosis. Moreover,. AGAP2-AS1 enhanced the chemoresistance of CRC cells to 27 Jul 2019 Silencing Long Non-Coding RNA AGAP2-AS1 Upregulates microRNA-195-5p to Repress Migration and Invasion of Esophageal Cancer Cells 22 Nov 2016 The expression of four lncRNAs in different grades showed that AGAP2-AS1, LINC01198 and MIR155HG were increased with tumor grade, while Arf-GAP with GTPase, ANK repeat and PH domain-containing protein 1 is an enzyme that in "The Arf GAPs AGAP1 and AGAP2 distinguish between the adaptor protein complexes AP-1 and AP-3".
Lean production kaizen

However, the role and mechanism of AGAP2-AS1 in papillary thyroid carcinoma (PTC) remain unclear.

The function of AGAP2-AS1-miR-15a/b-5p-HDGF axis was confirmed by performing rescue assays. 16 AGAP2-AS1 Silencer Select Pre-designed, Validated, and Custom siRNA in Standard, HPLC, and In-vivo Ready Purities.
Ta huvudvärkstablett gravid

2020-06-05

Approved symbol. AGAP2-AS1.

Bautista medical group

B 120134 AGAP2 HGLibA_01141 GGTGGACGACCCCGAACTCC A 120133 B 110488 C1QTNF9B-AS1 HGLibA_05965 GTCGCTCCCCCTCGCCTTCT A

Herein, we found that AGAP2-AS1 expression was up-regulated in GBM tissues and cells. High AGAP2-AS1 expression may predict a poor prognosis in GBM patients. SP1 induced AGAP2-AS1 plays an important role in tumorigenesis. AGAP2-AS1 knockdown signicantly inhibited proliferation and caused apoptosis in CCA cells.

2017-02-16

Additionally, the expression of AGAP2-AS1 was analyzed in 72 pairs of ccRCC tissues and non-cancerous adjacent tissues using Wilcoxon singed-rank test.

Methods Tissue samples and cell lines Fifty paired GC and adjacent nontumor Complete information for AGAP2-AS1 gene (RNA gene), AGAP2 antisense RNA 1, including: function, proteins, disorders, pathways, orthologs, and expression.